Skip to main content

Table 5 Results on real datasets. Results of Exit-point method on biological samples. The real motifs were obtained in all the six cases using the Exit-point framework.

From: Refining motifs by improving information content scores using neighborhood profile search

Sequence Sample Size t Best (20,2) Motif Reference Motif
E. coli CRP 1890 18 TGTGAAATAGATCACA TTTT TGTGANNNNGNTCACA
preproinsulin 7689 4 GGAAATTGCAGCCTCAGCCC CCTCAGCCC
DHFR 800 4 CTGCAATTTCGCGCCA AACT ATTTCNNGCCA
metallothionein 6823 4 CCCTCTGCGCCCGG ACCGGT TGCRCYCGG
c-fos 3695 5 CCATATTAGGACATCT GCGT CCATATTAGAGACTCT
yeast ECB 5000 5 GTATTTCCCGTTTAGGAAA A TTTCCCNNTNAGGAAA