Skip to main content

Advertisement

Table 3 iTriplet prediction using real biological sequences.

From: iTriplet, a rule-based nucleic acid sequence motif finder

Gene: Preproinsulin (IEB1) promoter+5' UTR Remarks
iTriplet GTYYGGAAAYTGCAGCYTCAGCCCC <25,2> model
PMSprune CAGCCTCAGCCCC TT Ref. [17]
MITRA CCTCAGCCCCC Ref. [14]
Published CTCAGCCCCCAGCCATCTGCCGACCCCCCC Transfac ID: R04457
Gene: DHFR (promoter+5' UTR) Remarks
iTriplet RWSTSGCGCSAAAC Y <15,3> model
PMSprune ATTTCG TG GGCA Ref. [17]
MITRA TGCAATTTC GCGCCA AAC Ref. [14]
Published ATTTCGCGCCAAA Transfac ID: R01928
Gene: Metallothionein promoter+5' UTR Remarks
iTriplet TTTTGCRC TCG YCCC <15,1> model
PMSprune CTCTGC AC ACGG CCC Ref. [17]
MITRA TGCGCCCGG Ref. [14]
Published TGCGCCCGG Transfac ID: R08298
Gene: c-fos serum response element promoter+5' UTR Remarks
iTriplet CCATATTAGGAC ATCTGCGT <20,1> model
PMSprune CCA AATTT G Ref. [17]
MITRA CCATATTAGGACA Ref. [14]
Published CAGGATGTCCATATTAGGACATC Transfac ID: R00466
3'UTR Regulatory Elements iTriplet Prediction only Published Remarks
AU-rich (ARE) TTTTATTTATTTT T WWTTATTTATTWW <14,3> model
Cytoplasmic Polyadenylation element (CPE) TTTTAAT TTTTAT and TTTTAAT <6,1> model
Pumillio binding element (PBE) T KT WAATA TGTAAATA <8,1> model
  1. Motif predicted by iTriplet is presented in consensus sequence. Bold and underlined sequence represents correctly predicted nucleotide. Transfac IDs are obtained from TRANSFAC database [37]