Skip to main content

Table 1 Designable RNA secondary structures

From: An image processing approach to computing distances between RNA secondary structures dot plots

Index Structure in dot-brackets notation Length (nt.) Output sequence of original RNAinverse [6] Output sequence of modified RNAinverse [6]
1 (((...(((...(((...)))...(((...)))...)))...))) 45 ACCGCCAGACAGGGCCAAGCCA- UCCAAAUUCAUAGUAUAAUACA-
    CAUCCUAAGGAAAAGAAAAAGGA CAUCCUAAGGAAAAGAAAAAGGA
2 (((.((.(((..((((((((.......)))))))))))...)).))) 47 GCUGUAGCCAAGUGGUAGUUGCU- GCGUUCCGUCAGACUCAUGAGGC-
    AUAAAAUUAUUAUGGAUGUAGGGU UAGGUCAUGGGUGACUCAGACCGC
3 (((((..((....((((.....)))).....))...))))) 41 GUCUGAAGCUCAAUGAUCUC- CUAGACCUCUUUAGUGGAAC-
    CAAUUAAACUCGUGUACGGAU GGCCGCGGACUGAAUAUCUAG
4 .((((((((((((...((.......))...))))))))).))) 43 CUCGUGAAUAUAACACUCAAG- AUUCAAAAAAAACAAAUCAAA-
    GACCGAAAUUUAUGUUUAGUGA AAAAGAAAAGUUUUUUUUAGAA
5 ((((..(((...((...(((((....)))))...))...))))))) 46 GGUUCAGUUCAUUGCUCAUACUU- UAUGUUAUCAAUUGUUGGCAUGC-
    AACGGUAUUCUCGUACGACAACC AGUCAUGCAUUCAUAGGGUCGUG
  1. This table displays the results for five designable secondary structures, comparing the original RNAinverse (using base pairing distance) output sequence, with the modified RNAinverse (using our proposed DoPloCompare distance) output sequence. Both algorithms succeeded in designing a sequence that folds into the input secondary structures, depicted in the second column, thus providing sequences with zero distance to the input structure.