Fig. 9
From: Mono-valent salt corrections for RNA secondary structures in the ViennaRNA package
Examples of structural transitions. MFE structures of a tRNA sequence at different salt concentrations are predicted with RNAfold. Within the concentration range from 0.011 to 6.6 M, the MFE structure is same as the one at the standard condition (C, D). The denaturation is observed at low concentration (A, B), while at high concentration (\(>6.6\) M, corresponding to a saturated saline solution), E become the MFE structure. The tRNA sequence used is GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA